• Santé - Méthode, Utilisation, Amorces

Séquençage

DOnc puisque la séquence génomique est inconnue, selon toi il est impossible d' effectuer une PCR...car le problème réside dans les amorces nécessaire à cette étape...mais suite à l'amplification de nos insert dans les vecteurs...il faudra bien que l'on dessine des amorces pour que la méthode de Sanger puisse fonctionnée.  [...] Il est possible d'amplifier un génome inconnu grâce à l'utilisation d'amorces universelles et/ou dégénérées. C'est la méthode utiliée pour l'identification bactérienne par RAPD (Random Amplified Polymorphic DNA).  [...]

[Biochimie] (licence/master) Question sur la pcr pour un rapport de stage, merci

c'est une PCR utilisant de petites amorces de séquences aléatoires ( 8-12 nucléodites)comprenant (60 à 70% G et C) puis une identification sur gel. C'est un moyen rapide pour identifier plusieurs espèces. C'est une méthode très sensible. Il y a pas besoin de connaitre les génomes.  [...] C'est une PCR qui permet d'étudier la variabilité d'un gène. On utilise des amorces ciblant un gène homologue sur les différentes espèces puis on utilise une enzyme de restriction puis on compare le profil sur gel. C'est une méthode plus longue que les autres PCR.  [...]

Conditions experimentales PCR, test primers !

Mon travail consiste a tester des couples d'amorces (primers F/R) afin de determiner les conditions experiementales pour leur utilisation. J'ai testé ces amorces avec une temperature d'hybridation standard donnée par les differents protocoles de PCR. 55°(diferente de celle indiquée sur les etiquettes des tubes des amorces) et la plus part de mes couples d'amorces ne donne pas de signal ou de signal specifique.  [...] . toutes vos idées à propos de ce que je fais me seraient utiles. determiner les bonnes conditions experimentales pour l'utilisation de differentes couples d'amorces (primers), comment savoir la bonne temperature d'hybridation, comment savoir combien de cycles de PCR pour chaque amorce.  [...]

Amplification de séquence

Existe t -il une méthode ou un protocole permettant de trouver précisément la séquence cible à amplifié, de trouver les amorces sens et anti-sens et valider le matching de ces amorces sur la sequence cible.  [...] 2 trouvez des primes dans NCBI primer blast en spécifiant la référence de la séquence (NM_00448.2 dans ce cas), qui vérifie qu'on amplifie bien la cible et aucune autre (avec les bons paramètres de Tm, de taille d'amplicon, etc.).   [...]

[Biologie Moléculaire] D'une protéine à un gène à une protéine

En revanche, il est possible de synthétiser l'ADN correspondant à la protéine séquencée. Cela s'appelle la méthode des gènes synthétiques. Il suffit de prendre des amorces recouvrant toute la séquence voulue. Les amorces sens et anti-sens s'hybrident en partie sur toute la séquence d'intérêt, on met une Taq sans activité 5'-3' exonucléase qui va combler les espaces.  [...] * plus grave encore. le biais d'usage du codon en général. les codons utilisés préférentiellement seront définis par plein de paramètres. %GC, biais lié à la position dans le génome (par exemple, chez les Métazoaires où tu as 2 sexes bien déterminés, tu as un biais lié au sexe.   [...]

[Génétique] gène de diagnostique C F. veneralis et C. fetus

je suis en stage dans un laboratoire d'analyse et nous cherchons à valider une méthode de diagnostique de la Campylobacter fetus veneralis à l'aide des 2 amorces ciblant les gènes.  [...] je cherche aussi à me renseigner sur le gène parA qui est utiliser dans d'autre méthode de diagnostique.  [...]

[Génétique] design des amorces

si on considère la séquence d'ADN SUIVANTE par exemple 5' [ATGGGCCCATGA ]TGCCGTCAGTAGGTCCCAGGTCGAATGCGC TGTCAC 3' on se propose de désigner l'amorce correspondante à la séquence entre crochets pour effectuer une amplification de l'ADN ça sera 5' TCATGGGCCCAT 3' j'aimerais bien savoir combien de codons je dois prendre en considération pour designer l'amorce je m'arrête là ou je continue après les crochets.  [...] De plus, d'après le principe de fonctionnement de la PCR (qui repose sur l'utilisation in vitro d'une polymérase), il ne faut pas une mais deux amorces (une forward en 5' et une reverse en 3') pour que l'amplification ait lieu.  [...]

séquençage de l'ADN

J'aimerais savoir comment faire pour connaitre la séquence de l'amorce pour le séquençage d'un gène en utilisant la méthode de sanger.  [...] 3°) On va ensuite concevoir un ou plusieurs couples d'amorces à tester en PCR (différentes paramètres à optimiser comme la température d'hybridation, la concentration en sels,...).  [...]

[Biologie Moléculaire] Méga-amorce avantage, inconvéniant

C'est vrai que j'ai oublié de préciser que c'était de la mutagenèse et j'en suis totalement désolé. méga amorce.png voici un schéma, la technique de la méga-amorce consiste si j'ai bien compris à faire 2 PCR successive. La premier produit après avoir été purifié est utilisé comme amorce pour la seconde PCR.  [...] J'ai aucun problème pour ce qui est de dessiner des amorces, de trouver les sites de restriction les plus adéquates mais je ne vois pas ce qu'apporte en plus la méthode et quelles peuvent être les inconvénients (peut être le coût Je sais que commander des amorces à un coût élevé ).  [...]

[Biologie Moléculaire] Problème PCR : Besoin d'aide

Est-ce que c'est toi qui a fait le design d'amorces ou est-ce que c'est une société qui vous les fournit automatiquement Car si tu as un programme du style Beacon pour faire ce design, je te conseille de l'utiliser car il est vraiment très fiable, en tout cas pour la méthode au SyBRGreen.  [...] Je me joins à LXR pour le conseil d'utiliser SyBR-Green. Il m'est arrivé un truc bizarre quand je travaillais sur le virus de la Dengue et celui de la Vallée du Rift en utilisant d'autres qPCR. j'avais l'impression de détecter des quantités correspondant uniquement au bruit de fond.  [...]