• Santé - Génome, Répétitions, Séquence

[Génétique] Transposons

On dit des transposons qu'il s'agit de séquences répétées dans le génome. D'accord, par définition. Mais entend t'on bien par là que ce sont des séquences répétées mais dispersées Je veux dire, les transposons ne sont pas des répétitions en tandem qui se suivent mais des répétitions dispersées dans le génome.  [...] Il me semble qu'il s'agit de séquences qui ont été répliquées, puis déplacées dans le génôme. Donc on retrouve dans le génôme X répétitions de la même séquence dispersées dans le génôme, mais il ne s'agit pas d'un enchaînement.  [...]

[Biologie Moléculaire] La génomique structurale !

Après, on passe à la carte physique qu'elle consiste d'abord à détérminer également la distance entre les locus en paire de base et puis à cloner tous le génome sous formes de séquence chevauchants par utilisations d'enzymes de restriction... Mais pk cloner tous le génome tandis que, ce que nous intéresse c'est qu'un seul gène.  [...] Une fois le brin d'ADN séquencé, il suffisait de raccommoder informatiquement le génome grâce au parties chevauchantes. Cette méthode est très rapide (surtout avec des centaines de séquenceur haut débit), mais ils ont eu des problèmes à cause des séquences hautement répétées (type centromère), car impossible de savoir le nombre de répétitions.  [...]

[Génétique] Génome humain: 22000, 24000, 25000 gènes ?

Secondly, despite all efforts, current technology is not able to sequence through 252 gaps in the genome representing approximately 37.2 million bp of euchromatic sequence (gene-rich regions). With an average gene size of 10-15kb and intergenic distance of 25-30kb, these gaps could easily produce another 1500 genes and gene variants.  [...] en fait ce nombre est différent d'un individu à l'autre. Il y a énormément de séquences répétées dans notre génome et le nombre de répétitions est variable (cherche par exemple short tandem repeat ). Et puis dans toutes les séquences il y a des insertions et délétions.  [...]

[Biologie Moléculaire] choix des amorces

en fait, je suis face à une séquence d'ADN, pour laquelle on me demande d'établir le profil des amorces que je peux utiliser sans pour autant me donner les enzymes de restriction qu'on peut utiliser.  [...] Il faut éviter surtout les séquences formant des structures secondaires (genre des tiges boucles). Enfin il faut faire attention a ce que les deux amorces choisies ne s'apparient pas entre elles, ni ailleurs dans le génome/plasmide (donc eviter les longues répétitions monotones de A, ou de C, ou de G, ou de T).  [...]

TPE sur l'ADN aide pour l'électrophorèse :)

Comment choisir les séquences d'ADN Quel est le lien avec les STR Une séquence de 12 répétitions d'un STR migrera plus vite que 15 répétitions.  [...] pour couper l'adn je sait qu'on a l'habitude d'avoir recours a des enzymes de restriction qui sont spécifique a certaines séquence sur l'adn mais honnêtement ça me semble très compliquer de réaliser ça a votre niveau.  [...]

Définition | CRISPR - CRISPR-Cas9 - Clustered Regularly Interspaced Short Palindromic Repeats | Futura Santé

CRISPR est l'acronyme de Clustered Regularly Interspaced Short Palindromic Repeats, soit en français courtes répétitions en palindrome regroupées et régulièrement espacées.  [...] Les séquences CRISPR sont des répétitions trouvées dans le génome bactérien et correspondent à des séquences de virus. Il s'agit d'un système de défense qui garde la mémoire de l'agression d'un virus. Les ARN codés par CRISPR se lient à l' enzyme Cas9 qui peut couper l' ADN du virus.  [...]

[Génétique] Question qui me tracasse beaucoup ( information génétique )

Il faudra bien choisir les enzymes de restrictions selon le plasmide mais également leurs séquences (par rapport à notre gène) car on va l'insérer grâce à la complémentarité des bases.  [...] Une séquence génétique/ADN (ex. un locus), c'est l'ordre d'enchaînement voire les changements de place et même répétitions des gènes considérés.  [...]

[Génétique] Problème de PCR

Mon segment d'ADN est constitué d'une suite de répétition de 6 bases. L'idée est d'utiliser une seule amorce (complémentaire à ma séquence répétitive) en espérant qu'elle se fixera au moins quelques fois au début du segment. Le profil que je m'attends à observer correspondrait à une série de pic avec le plus grand correspondant à la longueur de mon segment d'ADN.  [...] Ex de séquence de mon segment de contrôle. AATCCCAATCCCAATCCCAATCCCAATCCC AATCCCAATCCC... au total 20 répétitions de AATCCC.  [...]

[bio mol] Séquencage. RFLP

la sonde permet d'amplifier une séquence unique qui est situé en amont d'une séquence répetée. Le nombre de répetitions est différent selon les individus, on digére en amont de la sonde et en aval de la séquence répétée la taille du fragment sera variable selon les individus.  [...] RFLP pour polymorphisme (polymorphisme concernant les séquences répétées) des fragments de restriction (fragment contenant la séquence répétée+la séquence unique).  [...]

[Biologie Moléculaire] Séquence des domaines Ankyrine?

[Biologie Moléculaire] Séquence des domaines Ankyrine.  [...] Dans le cadre de mon travail de thèse je suis à la recherche de la séquence codant pour les répétitions ankyrin que l'on peut observer sur de nombreux gènes. J'ai fais pas mal d'article mais je n'en trouve aucun qui mentionne clairement la séquence. Dons si l'un de vous peut m'aider ce serait vraiment cool.  [...]