• Santé - Cellules, Lapin, Protéine

L'ADN et la synthèse d'une protéine

Des chercheurs ont isolé le gène codant pour une protéine de la membrane cytoplasmique de la paramécie puis l'ont transféré dans des cellules de lapin. Ils ont eu la surprise de constater que les cellulles de lapin ne synthétisaient jamais la protéine attendue mais seulement des fragments.  [...] La 1ère question étant. en utilisant le tableau du code génétique fourni, dites pourquoi les cellules de lapin sont incapables de synthétiser la protéine entière attendue.  [...]

Universalité du code génétique

Les cellules de lapins ne peuvent pas incorporer de cystéine au niveau du codon UGA (stop) puisque chez le lapin comme chez la plupart des organismes, le UGA veut dire STOP (sauf chez la paramécie ou il veut dire cytéine).  [...] Cela est lié au fait que les paramécies ont un ARNt capable de lire le codon UGA, alors que les cellules de lapin en sont dépourvus.  [...]

[Immunologie] Immuno-marquage

Un lourd sacrifice qui nous permettra de récupérer son sérum. Le sérum c'est en fait le plasma sanguin sans plaquettes ni cellules. On aura donc juste un plasma sanguin avec les anticorps qu'il nous faut. Voilà, mais en fait, le lapin va sécréter différents anticorps correspondant aux différents épitopes de la protéine.  [...] Mais faut savoir que chaque plasmocyte ne sécrète qu'un seul type d'anticorps. On choisira qu'un seul plasmocyte et on va en faire un hybridome( en gros. hybridation entre une cellule cancéreuse et un plasmocyte). Pourquoi on fait ça Tout simplement pour rendre le plasmocyte immortel car dans le corps le plasmocyte a une durée de vie très courte(de l'ordre du dixaine de jours si je me rappelle bien mais on s'en fou en fait ) Et donc voilà on a donc une jolie culture de plasmocytes qui sécrètent tous des anticorps contre la protéine qu'on veut observer.  [...]

[Biologie Cellulaire] Techniques d'étude de la cellule

C'est un outil très puissant pour visualiser un élément particulier dans une cellule. Exemple. tu veux visualiser chez la souris une protéine du cytosquelette, l'actine par exemple. Tu injectes de l'actine de souris dans un lapin, son système immunitaire va produire des anticorps contre l'actine de souris (l'antigène).  [...] Tu peux alors les récupérer, les purifier, et les coupler à une protéine fluorescente par exemple. Maintenant si tu mets tes cellules de souris en présence de cet anticorps, il va se fixer sur l'actine, et te permettre de la visualiser en fluorescence.  [...]

[Immunologie] protocole immuno-histo-chimique

permet de supprimer les interactions protéine-protéine non spécifiques en les occupant, ici avec des IgG non spécifiques de lapin.  [...] Les peroxydases sont des enzymes qui détoxifient des dérivés nocifs de l'oxygène, tu comprends bien que quand tu utilises une peroxydase pour mettre en évidence une protéine, il faut supprimer les endogènes pour ne pas parasiter ta coloration.  [...]

[Biologie Cellulaire] Création d'anticorps polyclonaux et monoclonaux

On injecte les antigènes (ou les protéines fusionnées a des éléments reconnus par le système immunitaire) a reconnaître à un animal (bien souvent un lapin), on attend qu'il produise des Ac conte cet antigène, on récupère les lymphocytes B de l'animal, on les met en culture pour qu'ils se multiplient et augmentent ainsi la quantité d'Ac, puis on lyse ces cellules et on purifie les Ac par HPLC.  [...] Tu peux te renseigner sur la technique (il y a des sites qui l'expliquent bien mieux que moi), mais la finalité sera la séparation des composants d'un mélange, donc ici, de séparer nos anticorps spécifiques de toutes les autres protéines contenues dans le lysat cellulaire.  [...]

Le mystère d'une transgénèse

Bonjour, comment expliqueriez-vous le fait que les cellules de lapin dans lesquelles on a introduit des gènes de paramécie codant pour des protéines membranaires ne synthétisent pas ces protéines mais seulement des fragments.  [...] En traduisant le brin transcrit d'ADN du gène en question (TATTTCTCCATGCCGCTCATTCGTGCACG A), je m'aperçois que le 7e codon de la protéine est le codon STOP, mais que dire de plus.  [...]

hybridisation in situ et immunomarquage

Tu vas trouver un epitope bien spécifique de ta proteine. Tu le surproduit et tu files ca à un lapin. Il va produire des anticorps polyclonaux contre ton epitope (ta proteine) et c'est eux que tu vas récupérer et utiliser (je simplifie, c'est le principe).  [...] Tout depend ce que tu cherches a faire. Si ta proteine n'est pas trop grosse, tu peux essayer de la produire entiere et de l'injecter au lapin entiere. Sinon, elle doit bien faire partie d'une famille de proteine. Si tu veux un anticorps specifique de ta proteine, tu fais un alignement et tu choisis un peptide divergent.  [...]

[Biologie Moléculaire] exercice sur la traduction et la biosynthese des protéines

2°)on parle d'un virus (mosaïque de tabac) qui permet de produire, (avec un lysat de réticulocyte de lapin, système classique contenant tous les éléments nécessaires a la traduction des protéines in vitro )deux peptides à partir d'une seule séquence d'ARN messager, qui ont la même séquence NH2 terminale.Il faut expliquer.  [...] CAA. Dans le cas des cellules de mammifères en culture, le taux de translecture atteint est de 2% (J.-P. Rousset, M. Cassan, manuscrit en pr éparation). dans les réticulocytes de lapin, 31% en pr ésence d'un ambre, 10% en pr ésence d'un ocre et 69% pour un opale (Valle et al. 1992).  [...]

[Biologie Moléculaire] Criblage d'une banque d'ADNc

pour la 3. on veut savoir si une telle protéine donc ARNm donc ADNc se trouve dans Xtissu dans Xcondition (on démarre par collection de tous les ARNm de la cellule soit des milliers pour faire le criblage d'une recherchée..).  [...] - on veut chercher la séquence d'un gène codant pour une protéine présente dans Xcellule dans Xcondition(donc on vérifie de ce fait si elle est présente dans cette condition et savoir la séquence du gène codant). et puisque le séquençage de protéines est trop difficile et peu fiable que le séquençage d'un ADNc on essaie de.  [...]