• Santé - ADN, Protéine, Question

Biologie Moléculaire [Evolution]

Nous sommes d'accord que pour une évolution protéique de base, il faut une mutation sur la partie codante d'un gène dans une cellule haploide qui.  [...] Déjà la TATA box c'est une séquence définit comme ça par l'homme, en réalité sur le gène c'est un enchaînement spécifique de bases qui créer une structure secondaire reconnaissable et qui facilite la fixation de la machine réplicative, transcriptionnel... Il faut que tu considère le premier organisme eucaryote qui avait un génome le plus simpliste au monde.   [...]

[Biochimie] dnase 1

Cependant voila j'ai une question de base mais je ne comprends pas le lien entre le fait qu'il y ait une protéine sur l'adn et le fait qu'on puisse en conclure qu'il s'agit de la région du promoteur.  [...] Admettons qu'un site du génome soit particulièrement ciblé par cette DNAse I. Je suppose que tu peux confirmer ce résultat en vérifiant que ce site n'est plus clivé la DNAse quand il est fixé par une autre protéine. Cette autre protéine empêche l'action de la DNAse, on dit qu'elle protège la séquence d'ADN dont il est question (je te propose une métaphore super naze pour illustrer.  [...]

génétique

j'aime savoir qu'est ce qu'une proteine sigmaet quelle est son role dans la transcription d'ADN car mon cours d'inscription ne parle pas de ce genre de proteine mais pourtant j'ai trouvé la question dans un controle.  [...] un promoteur fort est un promoteur utilisé par le complexe de transcription de base. un promoteur plus faible nécessite l'intervention de facteurs supplémentaires pour que la transcription soit initiée. dont les facteurs sigma par exemple.   [...]

Origine de l'origine

J'ai une question a propos de la synthèse des protéine qui me tarraude depuis quelque temps et qui est peut etre sans interet apparent, mais je n'arrive pas à y répondre. VOila. On sait que L'ARN-polymérase est une enzyme (donc une protéine) essentielle a la réplication de l'ADN pour donner 1 ARNm ( c'est très shématique).  [...] Mon problème est de savoir comment se sont synthétisé les premières protéines puisque il n'y avait pas par définition d'ARN-polymérase puisque il ne pouvait etre synthétisé.  [...]

Extraction d'ADN

j'ai récemment effectué un stage où mon travail consistait à extraire de l'ADN pour réaliser par la suite une amplification de cet ADN par RAPD.  [...] Lors de l'extraction de l'ADN on a utilisé de la protéinase K afin d'éliminer les protéines contaminantes, ma question est. est-ce que protéinase K = protéine kinase.  [...]

Génome humain

Pour la seconde question, la réponse est la régulation de la transcription. L'ADN humain possède quelque 20-25000 gènes. Ils ne sont pas exprimé en permanence ensemble dans une cellule au même moment (heureusement), mais certain sets de gènes vont être activés, produire la/les protéine(s) voulue(s), puis inactivés, avec des cycles (ou pas).  [...] Pour répondre à ta question. Si on a les mêmes gênes pourquoi l'information génétique est différente si un gène est l'expression de l'ADN codant pour l'expression d'une protéine mais qu'on a pas tous le même ADN.  [...]

[Biologie Cellulaire] Fixation d'une protéine à l'ADN

Je dois montrer comment une protéine qui se lie à l'ADN va réaliser des contacts spécifiques de séquences avec une molécule de l'ADN à double brin sans rompre les liaisons H.  [...] Je voudrais être sûre d'avoir compris la question. je pensais répondre qu'il pouvait y avoir liaison avec l'ADN si la protéine possède un domaine basique chargé + afin de se lier à l'ADN chargé -.  [...]

amplification de l'ADN

Je crois que tu mélanges deux trucs differents. l'adn polymérase qui duplique un simple brin en entier, et l'arn polymérase qui en copie une partie pour pouvoir la traduire ensuite en protéine. Precise donc ta question.  [...] mais je pose une question apres ca. Dans le cas de la duplication PRC, donc duplication d'une sequence determinee, quand vous dites.  [...]

Le mystère d'une transgénèse

Bonjour, comment expliqueriez-vous le fait que les cellules de lapin dans lesquelles on a introduit des gènes de paramécie codant pour des protéines membranaires ne synthétisent pas ces protéines mais seulement des fragments.  [...] En traduisant le brin transcrit d'ADN du gène en question (TATTTCTCCATGCCGCTCATTCGTGCACG A), je m'aperçois que le 7e codon de la protéine est le codon STOP, mais que dire de plus.  [...]

[Biochimie] Western Blot? Principe de la méthode?

EN gros quelle est la différence entre une electrophorese, et un western Blot qui utilise le principe de l'electrophorese, quelle est sa spécificité ( si ce n'est de s'interesser aux protéines).  [...] Bah justement, tu as donné la réponse dans ta question, il y a une étape de transfert sur membrane suivie d'une étape d' hybridation qui permet de mettre en avant de manière spécifique une protéine, un ADN ou un ARN.  [...]