• Forum - Structure, ARN, Séquence

Biochimie, structure secondaire de l'ARN

L'ARN de séquence. 5' - CGCGGAGUAAGGACGCCCGCG - 3' se replie en une structure secondaire dont les élements sont.  [...] Cherchez les bases qui peuvent s'appareiller au sein de cette séquence. CGCGG peut s'appareiller avec GCGCC donc il ya déjà une double hélice à 5 paires de bases Une seule des propositions comporte une double hélice à 5 paires de bases. Il s'agit de la réponse c.  [...]

[Biologie Moléculaire] siRNA, shRNA ??

Attention, l'extinction par le shRNA n'est stable que s'il est intégré dans le génome de la cellule hôte. Lors de la transfection de shRNAs, leur séquence est présente dans un plasmide. Leur expression est donc transitoire s'il n'y a pas intégration du plasmide dans le génome.  [...] Bonjour, Je ne dirai pas que le shRNA est le plasmide, c'est l'ARN en structure tige-boucle, qui peut être transcrit à partir d'une séquence intégrée dans un plasmide. Cette structure tige-boucle est reconnue par Dicer qui coupe la boucle, ce qui donne un petit ARN double brin comme un siRNA.  [...]

effet Antisens. A l'aide!

Cela se fait par injection d'ARN antisens, c'est à dire qui ont la séquence complémentaire à celle de ton ARN qui correspond à ta séquence codant pour ton enzyme.  [...] Le brin d'ARN étant normalement monocaténaire, si l'organisme se retrouve avec une séquence en sens inverse (antisens), les 2 brins vont s'apparier, pour former une structure double brin.  [...]

[Biologie Moléculaire] Résumer Génétique (absurde)

La terminaison n'est pas forcément liée à une séquence connue mais également à des séquences discrètes. Soit via l'apparition d'une structure secondaire dans l'ARN synthétisé soit via des facteurs protéiques.  [...] Les promoteurs et les terminateurs ne sont pas des introns. Les introns, c'est ce qui y'a entre les exons. Point. C'est dégagé lors de la maturation du pré-ARN (épissage). Tu as raison sur un point, ce sont des séquences non-codantes mais c'est tout.  [...]

[Génétique] endonucléases

Une endonucléase de restriction peut elle couper dans un exon.   [...] Bien sur, l'endonucléase ne reconnait que le type (ADN, ARN), l'orientation et la séquence d'un acide nucléique. Les séquences introniques et les exons mais aussi l'ADN non codant ont exactement la même structure et ne diffèrent que par leur rôle. Donc la présence d'un site de restriction suffit.  [...]

[Biochimie] introns dans ARNr

j'ai séquencé l'ADNg de la grosse sous-unité ribosomique mais je ne sais pas comment faire pour distinguer les introns des exons. De plus je pense que les signaux ne sont pas les mêmes entre ARNm et ARNr. J'ai trouvé des sites web sur la structure ARN mais en gros c'est juste une compil de tous les gènes trouvés.  [...] Je ne suis pas certains qu'il y ait des introns dans les ARNr (en tout cas pas dans ceux que je connais). Ils sont généralement fabriqués sous forme de grand précurseurs puis maturés pour donner les ARNr.   [...]

Prédiction structure ARN

Existe-t-il des logiciels/applications internet pour donner une prédiction supposée de la structure secondaire des ARN à partir de la séquence.  [...] tu peux aussi regarder sur le site de l'institut pasteur, il y a tout un panel de prog bioinfo en utilisation web. Pour les ARN tu en trouveras un ou deux pas mal je crois.  [...]

short hairpin RNA

Je suis pas un specialiste des shRNAs mais apres une recherche rapide sur le net il semble que le mecanisme d'action soit identique aux siRNA. La difference est dans la structure secondaire de l arn. Le shRNA est un arn simple brin qui forme une tige boucle(comme tu peux voir ici.  [...] qui est une structure tres bien exporte du noyau (reconnu par une exportine). Une fois dans le cytoplasme la tige boucle est reconnue et clivée par une RNAse (dicer) qui enleve la boucle et la tu te retrouve avec un arn double brin (un siRNA en gros) avec une sequence complementaire a sa cible.  [...]

Problème RT-PCR sur cDNA

Par la façon dont tu exposes ton problème, j'ai l'impression que tu ne connais pas la structure exacte intron/exon de ton gène... J'imagine que c'est pour ça que tu séquences le cDNA. Une chose est sûre. entre les prédictions des sites d'épissages et une preuve biologique (ADNc séquencé), c'est la preuve biologique qui gagne.  [...] Conclusion, soit tu as une erreur de prédiction de la structure intron/exon de ton gène, soit tu as un epissage alternatif, soit tu as séquencé de l'ADN génomique (contamination de ta prep' d'ARN) -. As-tu fait un traitement à la DNase.  [...]

structure de l'ARNm mature -> régions non codantes

Ces séquences UTR ne codent pas mais sont tout de même indispensables pour le bon fonctionnement de la traduction. Tout les facteurs de régulation(élement cis et trans) s'y trouvent, c'est juste.  [...] Pour un ARNm, on parle plutôt de régulateurs post-transcriptionnels. on peut trouver des riboswitch (riborégulateurs) dans la 5' UTR, il s'agit d'une courte séquence d'ARN dont la structure secondaire peut adopter deux conformations, en fonction de la liaison ou non à un ligand.  [...]