• Forum - Segment, Séquence, Longueur

SVT: la molécule d'ADN

En ce qui concerne la séquence nucléique, c'est-à-dire l'enchainement de nucléotides sur l'ADN, elle est propre à chaque organisme.  [...] Les gènes, sont des segment de séquence nucléiques de longueur variable. Ils sont composés d'un enchaînement de nucléotides, sans ordre particulier, et de longueur variable. Certains gènes sont très conservés au sein du vivant, et certains sont spécifiques de certaines espèces.  [...]

[Génétique] Problème de PCR

Mon segment d'ADN est constitué d'une suite de répétition de 6 bases. L'idée est d'utiliser une seule amorce (complémentaire à ma séquence répétitive) en espérant qu'elle se fixera au moins quelques fois au début du segment. Le profil que je m'attends à observer correspondrait à une série de pic avec le plus grand correspondant à la longueur de mon segment d'ADN.  [...] Ex de séquence de mon segment de contrôle. AATCCCAATCCCAATCCCAATCCCAATCCC AATCCCAATCCC... au total 20 répétitions de AATCCC.  [...]

[Biologie Moléculaire] comment faire une mutation par PCR?

La mutagenèse permet d'obtenir un court segment de séquence comprenant la région mutée. Il faut ensuite remettre cette séquence dans le plasmide d'origine, à la place du petit segment non-muté. Le meilleur moyen de le faire c'est par simple clonage grâce à des enzymes de restriction.  [...] La mutagenèse permet d'obtenir un court segment de séquence comprenant la région mutée. Il faut ensuite remettre cette séquence dans le plasmide d'origine, à la place du segment non-muté. Le meilleur moyen de le faire c'est par simple clonage grâce à des enzymes de restriction.  [...]

microbiologie (sens anti-sens)

après une recherche sans succès sur le forum futur-sciences, j'aurai besoin d'une petite aide, dans mon cours on fais souvent référence dans une cartographie de restriction a une orientation sens ou anti-sens par rapport au promoteur mais je ne comprend pas vraiment ce que cela signifie (sens et anti-sens, si quelqu'un veut bien m'éclairer.   [...] on a deux plasmide, on va transplanter pour chacun un fragment d'ADN, on partique l'experience avec des Enzyme de restriction et ensuite on place les fragment dans un gel et on laisse migré(cartographie de restriction).   [...]

Question au sujet de la séquence Shine-Dalgarno

j'ai lu que, pour la traduction d'un ARNm procaryote polycistronique, l'ARN polII doit reconnaître une séquence spécifique - séquence Shine-Dalgarno (5'-AGGAGG-3')- située en amont du codon start (AUG) pour pouvoir traduire le bon segment de nucléotides. Je ne comprends pas vraiment l'utilité de cette séquence, sachant que AUG est déjà significative, il n'y aurait pas besoin de rajouter une séquence pour l'identifier, non.  [...] Elle permet de distinguer un AUG initiateur d'un AUG codant pour une méthionine à l'intérieur du gène. De plus, la nature de la séquence est variable, ce qui permet de moduler le taux d'initiation de la traduction en fonction de l'affinité de l'ARNr 16s du ribosome.  [...]

[Zoologie] Insecte mystère - Page 5

Voir les antennes. Chez Agapanthia le premier segment est noir, les parties noires et blanches sont de meme longueur entre autres differences avec Anaerea.  [...] Anaerea est un peu plus grand, ses élytres sont moins couverts de soies, et plus ponctués, les antennes peut-e^tre un peu plus courtes, et le deuxième article antennaires d'Agapanthia me semble plus long.   [...]

mystère de séquences...

Après séquençage de 3 génotypes avec la même amorce, nous avons 3 séquences qui a parti du même endroit, a un décalage d'environ 15 bases (je n'ai plus le nombre exactes mais c'est le même pour les 3).  [...] Ca sent très fortement la séquence répétée. Ton amorce se fixerait à plusieurs endroits, tant que tu es dans la région répétée ta séquence semble normale et quand tu atteinds les régions variables, tu obtiens un mélange de séquences. Utilise le programme blast en donnant comme élément à rechercher ton amorce (ou mieux, un segment de 50 nucléotides issus de la partie propre de la séquence).  [...]

aidez moi

je ss une etudiante en electronique t je prepare mon PFE qui est basé sur la rééducation des membres supérieurs mai j'ai pas des notion sur l'anatomye du bras cher l'Homme.   [...] si vous pouvais m'aider j'ai pesoin des longueur des segment du bras (bras,avans bras...) chez l'adute (femme et homme) et chez les enfants.  [...]

UMI Unique Molecular Identifier

J'ai un problème pour comprendre concrètement ce qu'est un UMI (dans le cadre du RNAseq) et quoi ça sert.   [...] Il s'agit d'une petite séquence ajoutée à chaque segment analysé pour lui permettre de l'identifier. Ca permet de limiter les erreurs de séquençages liés aux erreurs de réplications.  [...]

[Biologie Moléculaire] Gène Chevauchant ça veux dire quoi ?

- d'éventuels opérateurs (segment d'ADN où se fixent le répresseur) ou plus généralement des séquences régulatrices cis (c'est à dire localisé dans ou autour du gène) et.  [...] Zoom sur gène. fragment d'ADN composé d'un promoteur (séquence non codante, non transcrite )+ succession d'introns (séquence non codante) et d'exons (séquence codante) toutes les 2 transcrites + un terminateur (séquence non codante, non transcrite).  [...]