• Forum - Génome, Utilisation, Amorces

Rep-pcr

Est-ce que quelqu'un connais un site dans lequel je pourrais trouver une documentation assez détaillée concernant la REP-PCR.   [...] Même principe que la PCR ordinaire... Ce n'est qu'une PCR en fait... L'originale dans cette méthode c'est l'utilisation d'amorces consensuelles, homologues de séquences répétées, Ce sont les éléments REP (pour Repetitive Extragenic Palyndromic element). Dans un génome bactérien, ces éléments représentent environ 0.  [...]

Séquençage

J'ai juste une petite question, dans les projet de séquencage de génome de grande taille l'utilisation de vecteur est nécessaire. Je sais que la séquence d'ADN que l'on veut étudier doit être scindée afin de placer les inserts obtenus dans des vecteurs. Ces vecteurs seront ensuite clonés à l'aide d'organisme hôtes.  [...] Il est possible d'amplifier un génome inconnu grâce à l'utilisation d'amorces universelles et/ou dégénérées. C'est la méthode utiliée pour l'identification bactérienne par RAPD (Random Amplified Polymorphic DNA).  [...]

[Biologie Moléculaire] Criblage d'une banque d'ADNc

Je crois aussi que l'utilité des banques ADNc est encore moindre avec la variances des techniques de PCR. Or, si tu as besoin d'un gène, il suffit de désigner des primers puis d'essayer de l'amplifier à Partir de l'ADN génomique ou une population des RNAm synthétisée par la reverse transcriptase.  [...] Et puis, c'est facile maintenant avec les connaissances du génome de choisir les amorces pour faire la RT, mais sans cela, comment être sur que ton cDNA est entier, qu'il est bien splicé, etc... En outre, si tu veux faire une recherche par homologie de séquence, l'utilisation de la banque était la seule solution pour trouver tous les variants de splicing, gènes homologues, etc.  [...]

[Biologie Moléculaire] Technique pour obtenir des amorces souche spécifique sans séquence du génome

Je sais pas si c'est courant de faire ça mais peut être amplification et séquençage du 16S et utilisation de sondes spécifiques pour la qPCR.  [...] Tu récupères des séquences d'un même gène de ton espèce d'intérêt ainsi que d'autres que tu ne veux pas quantifier, tu les alignes avec un logiciel d'alignement, et tu t'amuses à trouver des endroits ou la séquence est différente. Après il te faut avoir de la chance et que des amorces puissent être créées dans cette zone.  [...]

[Biologie Moléculaire] Comment séquencer un génome inconnu ?

Si ce n'est pas le cas comment fait-on pour choisir des amorces alors qu'on ne connaît pas du tout le génome.  [...] Même s'il est juste que la méthode de Sanger est encore utilisée, elle est aujourd'hui assez largement dépassée. Il existe maintenant des méthodes bien plus performantes. Voici un article qui j'espère vous aidera. lien.   [...]

[Biochimie] Rt-pcr

j'ai plusieurs question concernant la RT-PCR. Est ce que la RT et la PCR ce font dans le même tube. Sur un genome procaryote constutuer d'ORF, faut il utiliser deux amorces spécifique de la region que l'ont souahite amplifier Ces amorces sont elles les meme pour la RT que pour la PCR La PCR peut elle se faire avec juste le cDNA synthétiser ou bien il faut faire les 2 brins d'ADN.  [...] Merci de vos reponse car la je galére un peu sur ma publication.   [...]

[Biologie Moléculaire] Séquençage

Quand on effectue un séquençage à haut débit (NGS) on obtient donc la séquence ADN de tout le génome =. Prise de sang - Extraction ADN génomique - Purification - PCR - NGS.  [...] Quand on fait un Whole Exome sequencing, on s'interesse à 2% du génome, la région codante. Qu'est ce qui change dans le protocole expérimental pour isoler cet ensemble de régions =. Un choix d'amorces PCR spécifique pour exons.  [...]

[Génétique] design des amorces

si on considère la séquence d'ADN SUIVANTE par exemple 5' [ATGGGCCCATGA ]TGCCGTCAGTAGGTCCCAGGTCGAATGCGC TGTCAC 3' on se propose de désigner l'amorce correspondante à la séquence entre crochets pour effectuer une amplification de l'ADN ça sera 5' TCATGGGCCCAT 3' j'aimerais bien savoir combien de codons je dois prendre en considération pour designer l'amorce je m'arrête là ou je continue après les crochets.  [...] De plus, d'après le principe de fonctionnement de la PCR (qui repose sur l'utilisation in vitro d'une polymérase), il ne faut pas une mais deux amorces (une forward en 5' et une reverse en 3') pour que l'amplification ait lieu.  [...]

PCR recherche d'une mutation

Je suis actuellement en angleterre dans un des plus grands centres de recherche et on me demande de rechercher une mutation au niveau d'une proteine du sodium channel, je n'ai jamais fait ca je comprends la moitite de ce que les gens disent bref je suis perdue, j ai differents genotypes puisque differents clones de pucerons et je dois verifier qu ils ont bien la mutation sur cette proteine... je suis sensee faire quoi.  [...] La première chose serait donc de récupérer les séquences des différents génotypes, de les aligner (logiciel Mega par exemple) pour repérer la mutation (s'agit-il d'un SNP ou autre ).  [...]

PCR sur colonie après insertion chromosomique... ?

Cependant, ce que je ne comprends pas, c'est que j'ai à la base étalé après électroporation mes bactéries sur un milieu contenant la kanamycine. Théoriquement, les bactéries qui y poussent devraient donc avoir intégré par recombinaison homologue TAP + Kan dans leur génome non.  [...] EDIT, Ah oui et il y a aussi comme Tibosax l'explique la possibilité que ca soit pas intégré au bon endroit, ducoup ta bactérie aurait la résistance mais pas le construct, ducoup vu que tes amorces sont sur deux parties du génome qui seront éloignées, pas d'amplification.  [...]