• Forum - Designer, Amorces, Séquence

[Biologie Moléculaire] Comment designer des primers

J'ai un souci avec le design des primers. J'aimerai savoir comment procéder. Si j'ai une séquence comme celle ci. GCACCGGGGATCCTAGGCTTTTTGGATTGC GCTTTCCGACAGATCAACTTGGTGTTGGAC TCTGTCCTGTTTTAGGATGGGTCAGATTGT GACGATGTTTGAGGCTTTGCCTCACATCAT TGATGAGGTTATCAACATTGTCATCATAGT GCTCATCATAATCACGAGCATCAA.  [...] et que je voudrai designer un couple de primer avec un en début de séquence et autre à la fin, comment pourrai-je faire Je crois savoir que pour l'amorce inverse il faut d'avoir faire le brin complémentaire et ensuite prendre le sens 3' 5'. Mais j'aimerai en être certaine. Quelqu'un pourrait-il me donner un exemple.  [...]

[Biologie Moléculaire] Hybridation in situ

je suis en thèse et je dois réaliser une ISH or je n'en ai jamais fait de ma vie. j'ai récupéré des protocoles mais je voudrais savoir comment faire le design des amorces pour mon gène avec T3 et T7 HELPPPPPPPPP.  [...] Les amorces c'est pour designer la sonde que l'on va insérer dans un vecteur qu'il faudra ensuite linéariser par restriction selon l'orientation et transcrire (souvent avec la T3,la T7 ou la SP6 polymérase) pour obtenir de l'ARN.  [...]

miRNA

J ai commandé des miRNA dont la séquence cible correspond donc au brin qui ne sera pas transcrit. Mais sachant que le miRNA est double brin est ce que quand meme un des deux brins pourra se fixer sur ma sequence cible En bref lorsqu on a un miRNA les deux brins peuvent interferer avec un ARN ou seulement un seul est amener à l ARN.  [...] En pratique, l'efficacité peut énormément varier étant donné qu'elle dépend de la séquence du siRNA. Par exemple, il est préferrable d'avoir un A en position 3 et un G en position 13. De même il vaut mieux des pyrimidines aux positions 15-19. Si tu fais l'effort de bien designer ton siRNA, l'antisens sera probablement peu efficace.  [...]

[Biochimie] nouvelle sur le forum et besoin de vs pour du clonage, help

Je suis chercheuse en cancérologie et je vais débuter dans un domaine que je ne connais absolument pas, je dois cloner deux séquences d'un gène bien spécifique, et pour cela je dois cloner cela par PCR.Le problème est que je ne sais mm pas designer des primers, donc j'aimerais un peu d'aide dans ce domaine, pour ne pas faire de bétises. Merci d'avance.  [...] Pour la PCR le site internet qui va bien est primer3. Vous entrez votre séquence et il vous donne des oligos qui fonctionneront dans 95% des cas. Si vous souhaitez amplifier de longfragments (. 3kb) pensez à utiliser une PCR long range (type long expent de chez Roche).  [...]

[Biologie Moléculaire] Choisir le bon vecteur?

Toi tu veux cloner un ARNm. Il te faut déjà le rétrotranscrire en ADNc. Ensuite la première chose que je ferais dans ton cas c'est un 5'-RACE pour conserver la partie 5' de mon ARNm et pouvoir y coller le site de restriction que je veux. Ensuite pour la partie 3', les ARNm ont en commun une queue polyA donc tu peux t'en servir pour designer l'amorce 3' de la PCR permettant d'amplifier la totalité de ton ARNm, et tu colles en 5' de ton amorce 3' un site de restriction différent.  [...] En suite on trouve les choses pertinentes pour votre travail. Deux cassettes de clonages qui entourent le gène de la luciférase + polyA cs. L'idée de ce vecteur est de cloner des promoteurs ou des séquences régulatrices pour tester dans quel mesure des facteurs cis et trans activateurs peuvent activer la transcription de la luciférase.  [...]

Le virus : un être vivant ?

... le vivant est un terme vulgaire, pour désigner la chimie basé sur le carbonne.. qui contient en soi un pr ésuposé vitaliste, un souffle divin.. une anima, ame qui ferasi remuer et evoluer le tout.  [...] la notion de vivant reste toute fois employé comme etant très descritptif de la chimie du carbonne... c'est celle qui est employé par les juriste pour designer cete ensemble chimique.  [...]

[Biologie végétale] Bryophytes??

Je dirais que les Bryophytes se développent généralement mieux en milieu humide et ombragé (nécessaire à leur croissance). Beaucoup sont reviviscents et peuvent donc supporter une période assez longue de sécheresse.   [...] Mais maintenat on trouve des classifications ou bryophyte désigne un groupe à l'intérieur de l'ancien groupe des bryophytes. Cet ancien groupe est du coup constitué des marchiantophytes, anthocérophytes et bryophytes.  [...]

Du sang qui sort en grande quantité de la bouche...

Ze voulait juste savoir ce que sa pouvait être car dans les différents textes à ce sujet il n'y a pas de réference à une quelquonque maladie.   [...] Je relance le débat,*bonjours*à tous je suis*nouvelle sur ce site, que j'ai trouvé en cherchant, justement, une réponse à ce problème de sang dans la bouche. Mais*pour*mon cas le précise que sa ne vient ni*des gencives, ni de caries. Je n'ai pas de reflux gastrique avant, ni de toux, j'ai l'impression que ça arrive comme par les *pores* sécrétant la salive.   [...]

[Biologie Moléculaire] Dessin de Primer pour qPCR - BLAST

En effet le lien que tu parle permet de dessiner des primers à partir d'une séquence que tu donne, mais en général, je vérifie toujours les couples qu'il me donne en faisant un Blast par la suite(blastn pour etre précis). Et c'est là qu'apparait le fameux misc_RNA dans certaines occurences.  [...] Je crois que l'intérêt d'utiliser le bon outil est qu'il est designé pour. BLAST est un programme paramétrable. Afin d'en simplifier l'utilisation par les personnes non versées dans l'informatique il existe plusieurs interfaces disponibles préparamétrées. C'est à dire que des personnes ont réfléchi aux réglages les plus pertinants pour arriver le plus souvent au but qu'ils se sont fixer.  [...]

[Biologie Moléculaire] Généralité génétiques(ADN,gène,chromosome s..)

En ce qui concerne les séquences non codantes, on ne sait pas encore tout dessus. Quoi qu'il en soit, elles limitent sans doute le nombre de mutations létales (un changement aura moins de conséquences dans le charabia nucléotidique que dans un exon).  [...] L'ADN n'est en fait pas le même pour tous. pour se limiter aux parties codantes ( je n'étudierai les parties non codante qu'ultérieurement au cours de mon année de première ), les séquences de nucléotides ne sont pas les mêmes d'un individu à un autre. J'ai, il y a quelque jours, étudié le cas d'un individu drépanocytaire et celui d'un sujet n'ayant pas cette maladie qui touche les hématies.  [...]