• Forum - Cellules, Lapin, Protéines, Fragments

Le mystère d'une transgénèse

Bonjour, comment expliqueriez-vous le fait que les cellules de lapin dans lesquelles on a introduit des gènes de paramécie codant pour des protéines membranaires ne synthétisent pas ces protéines mais seulement des fragments.  [...] En traduisant le brin transcrit d'ADN du gène en question (TATTTCTCCATGCCGCTCATTCGTGCACG A), je m'aperçois que le 7e codon de la protéine est le codon STOP, mais que dire de plus.  [...]

L'ADN et la synthèse d'une protéine

Des chercheurs ont isolé le gène codant pour une protéine de la membrane cytoplasmique de la paramécie puis l'ont transféré dans des cellules de lapin. Ils ont eu la surprise de constater que les cellulles de lapin ne synthétisaient jamais la protéine attendue mais seulement des fragments.  [...] On vous indique que l'on ne trouve que des fragments de la protéines. On ne la voit donc jamais complète. Peut être ceci vous incite il à poser une hypothèse. Qu'est ce qui selon vous peut conduire à l'arrêt de la synthèse protéique (ne vous demandez pas pour l'instant si c'est possible dans votre cas précis, listez juste les causes que vous connaissez).  [...]

Universalité du code génétique

Les cellules de lapins ne peuvent pas incorporer de cystéine au niveau du codon UGA (stop) puisque chez le lapin comme chez la plupart des organismes, le UGA veut dire STOP (sauf chez la paramécie ou il veut dire cytéine).  [...] Cela est lié au fait que les paramécies ont un ARNt capable de lire le codon UGA, alors que les cellules de lapin en sont dépourvus.  [...]

Help: rôle des protéines!

J'aimerais bien expliquer rapidement (mais sans dire qd même trop d'aneries.) à nos visiteurs le rôle de ces protéines dans la vie cellulaire.  [...] tout ce que l'on consomme passe par le tube digestif où c'est digéré par des enzymes. Les protéines sont entièrement dégradées en acides aminés qui serviront à nos cellules pour fabriquer nos propres protéines (grâce au code génétique). un peu comme un enfant qui démonte une voiture en lego pour fabriquer une maison.  [...]

[Immunologie] Immuno-marquage

Ok alors la première façon de faire c'est de prendre un lapinou et du lui injecter les protéines qu'on veut marquer. Celà va activer son système immunitaire(de défense) et donc les globules blancs du lapinou vont sécréter des anticorps contre cette protéine.  [...] Un lourd sacrifice qui nous permettra de récupérer son sérum. Le sérum c'est en fait le plasma sanguin sans plaquettes ni cellules. On aura donc juste un plasma sanguin avec les anticorps qu'il nous faut. Voilà, mais en fait, le lapin va sécréter différents anticorps correspondant aux différents épitopes de la protéine.  [...]

[Biologie Moléculaire] exercice sur la traduction et la biosynthese des protéines

2°)on parle d'un virus (mosaïque de tabac) qui permet de produire, (avec un lysat de réticulocyte de lapin, système classique contenant tous les éléments nécessaires a la traduction des protéines in vitro )deux peptides à partir d'une seule séquence d'ARN messager, qui ont la même séquence NH2 terminale.Il faut expliquer.  [...] En tout cas désolé mais les aa-ARNT synthétases ne sont jamais limitantes dans un systeme in vitro (principalement car on ne produit jamais assez de protéines pour épuiser les tRNA). Par contre en effet, il peut y avoir une explication que seules les aa-ARNT de tetrahymena sont capables de charger l'ARNt suppresseur qui proviens lui aussi de tetrahymena.  [...]

[Microbiologie] immunisation des lapins par les protéines recombinantes

[Microbiologie] immunisation des lapins par les protéines recombinantes.  [...] je dois injecter aux lapins des protéines recombinantes issues de la souche Mycoplasma. Qu'est ce que je dois faire pour purifier ces protéines recombinantes et après lorsque je vais récupérer le sang de lapin immunisé comment pourrais je le purifier pour récupérer uniquement le sérum.  [...]

[Biologie Moléculaire] extraction de l'ADN tumoral

Peut-être procéder d'abord à une immuno-lyse via des Ac de lapin ou autre anti-lymphocytes humains, puis récupération des cellules par microfiltration et enfin extraction de l'ADN.  [...] Sinon, tu ne peux pas sortir tes cellules tumorales par FACS En te basant sur des marqueurs membranaires qu'elles sur ou sous-exprimeraient par rapport à tes lymphocytes non tumoraux.  [...]

[Biologie Moléculaire] question concernant la comparaison des ADN entre les organismes

Lorsqu'il y a mutation sur une séquence codante, la protéine peut etre altérée. Soit elle est essentielle, et la protéine rend impossible la vie de l'organisme. Soit son alteration devient pathogène pour la cellule, et rend impossible la vie de l'organisme.  [...] Ca ne veut pas direque toutes les protéines exprimées chez le singe sont les meme que chez l'homme (idem de l'homme au lapin). Cela veut simplement dire qu'il faut un concours de circonstances aléatoires plus difficile a observer dans le cadre d'une séquence codante.  [...]

[Biochimie] Synthèse de protéines in vitro

En relisant mon cours aujourd'hui, je suis tombé sur la synthèse in vitro de protéines. On nous y explique que le mécanisme est assez simple. par lyse de certaines cellules, on y récupère toute la machinerie nécessaire à la fabrication des protéines (ribosomes, tRNAs, tRNA synthétase, tous les facteurs,etc.  [...] ..) et que, à partir de là, on peut ajouter notre séquence d'ARNm afin de provoquer la synthèse de notre protéine. Un petit détail me chiffonne pourtant. dans notre lysat, il y a également tous les ARNm de la cellules lysée, et toutes ses protéines vont aussi être traduites.  [...]